Monday, February 23, 2009

Converting flv file into avi file without software

In this post I am going to tell you how to convert a flash file(.flv) into .avi file, and that too without installing any additional software. Many paid softwares and free softwares are available on the net which enable you to convert a .flv file into .avi file, but why waste your hard disk memory when the video conversion can be done by following a simple trick. Before I tell you the trick let me thank my friend who told me about this method. Just implement the following steps-

Step1
Download this rar file, extract it to any folder. That folder will comprise of many files, one such file would be named "ffmpeg". Now paste this file in the Windows folder, usually the path of the Windows folder is C:\Windows. This file is a binary file with precompiled instructions.

Step2
Suppose we have to convert a .flv file named A.flv which is present in the folder Max. Consider that the folder Max is located in C:, so the path of the .flv file would be C:\Max\A.flv. Go to command prompt, type "cd C:\Max", we would be enterting the Max folder comprising of the file A.flv. Now type "ffmpeg -i A.flv A.avi", this command will convert the .flv file into .avi file.

I hope this post was useful, if you have any doubts fell free to tell me and I shall solve your query.

Monday, January 19, 2009

Dot Plot

The article like the article below titled "Sequence Alignment Techniques" is related to the field of Bioinformatics. In the field of Bioinformatics Sequence Matching and Sequence Alignment play an important roll. By using Dot Plot we can do Sequence Matching, people of other fields can also view this article as a novel method of matching a pair of words.



Let us view the procedure-
Suppose we have 2 sequences,
Sequence1- ACCTGGAAA
Sequence2- AGGTCCAPP

Place Sequence1 on X axis and Sequence2 on Y axis
Figure1- The Matrix






Compare each element of X axis and Y axis, plot a point whenever same element occurs.



Figure2- Plotting of points





Now join, the points with diagonal lines.

Figure3- Joining of points which occur in diagonal boxes



I am a student of Bioinformatics, below I have written a code in PERL language which can generate a Dot Plot between any 2 sequences, this PERL code will be a useful reference for graduate and undergraduate student of Bioinfomatics.

THE CODE
(Uploaded on 22/4/2009)


* Note- My dear friend, if you are downloading the code kindly include a comment. Your comments mean a lot to me and will encourage me to write more.

Monday, October 20, 2008

THE RELATIVE BIOSPHERE HYPOTHESIS

A lot of speculations have been made on extra-terrestrial life[life on other planets].Various techniques of Radiography,Satellites,Interplanetry Robotic missions have been used to detect extra-terrestrial life,---------but have meet with no success.

According to me life exists on electrons.Confused?The similarity between the planetary orbits and electron orbits is more than a mere coincidence.The similarity between the configuration of an atom[electrons revolving around a dense nucleus] and our solar system[planets revolving around a dense Sun] does indicate something.It indicates that as life exists on earth similarly, at the atomic level life would exist on the electrons.

There would not be any difference in the life of that miniperson living on the electron and us.Probably he/she has the same lifestyle and similar surroundings but ofcourse,the time factor in that electron would be very different.Probably the entire existence of that mini planet[electron] would be one millionth of a second..Suppose a person from that miniplanet would travel to a bigger planet[say our EARTH] and after a time interval of few seconds retuns back to his/her own planet what would he find?The answer is that he/she would find his planet missing since the whole existence of his/her planet is only millionth of a second.

But why should we consider ourselves fortunate?Therotically it is possible our planet is an electron like particle to a much bigger mega planet.Our existence for billions of years might seem a very short period of time to those mega planet people and might be only a small component of a odinary process[like bursting of a cracker].

This leads to the existence of the relative size of the planets as proposed by relative biosphere hypothesis.In it the size of the planets at different levels would come under a number line.






Monday, September 15, 2008

Apple iPhone is not worth it!



The Apple iPhone was recently launched in India. The 8GB version costs a mammoth 31,000 INR($680) , while 16GB version is available at 38,000 INR($800). In USA, the phone would be available at a much cheaper rate.


So, does the iPhone live up to its hype!!! Definitely not! The phone is good but not good enough for the price. It has many technical and no-technical flaws. It is highly surprising that such a technically suave phone lacks basic features like bluetooth and videorecording. It does not have a search option in the Contacts List. Although it is a GSM phone, it is only available in 2 networks, namely Airtel and Vodafone, and that too without any contract.


Recent reports have suggested that the chipset has technical glitches. This is definitely, not good news for people with a high security priority. A technical expert in India, said this "Suppose a malicious code is running in my iPhone, Apple can shut off the phone". Now thats my phone, what right does Apple have to shut it. I have paid full amount for that phone and I do not even have full control over it.


However I have to agree that Applee has created good hype, and marketed the product excellent well in India. Its music quality, browsing features and accessory utilities are of very high standard. I reccomend this phone, only to hardcore music lovers and net surfers.


Rating-2/5


Monday, August 11, 2008

Sequence Alignment Techniques

Sequence Alignment Techniques are very useful in the field of Bioinformatics. Bioinformatics is the application of computer technology in the field of Biology.

Within the nucleus of our cells, a very fine thread like structure is present known as chromosome. The chief component of chromosome is the DNA( Deoxyribonucleic acid). Without getting into much detail, just know this that the DNA can be represented as a string of letters. Example- ACCTGATCGATCAGTGACGAT, such strings are known as DNA sequences.

Let us align 2 DNA sequences. Seq1- ACTG Seq2- ACTP. Without using any algorithms, we can determine the alignment of these 2 sequence.


Suppose the sequences to be compared are much more complex, say

Seq1- ABCNYRQCLCRPM( Query Sequence )
Seq2- AYCYNRCKCRBP( Subject Sequence )

In such cases, we use algorithms; 2 main algorithms used are Needleman-Wunsch algorithm and Smith-Waterman algorithm. The former is used for Global Alignment while the latter is used for Local alignment. In Global Alignment the whole of the query seqence is compared to the subject sequence for alignment. In Local Alignment, the query sequence is partioned and , and the bits are compared to the subject sequence. Let us solve the above problem using Needleman-Wunsch algorithm.
3 steps are involved-
=> Initiation of the matrix
=> Filling up the matrix
=> Tracing back



=>Initiation of the matrix

Before we initiate the matrix we have to assign the match value, mismatch value and gap value. Let us keep, match=5 mismatch=-3 gap=-4

The initialized matrix is as follows-

Figure1- Initialized matrix

The query sequence is placed as a row on the top. The subject sequence is placed as a column on the side. 0 is the origin of the matrix. The first row of the matrix is filled with values, as the multiple of the gap value( i.e. -4 is the gap value in this case, so the first row would be filled as -4, -8, -16.... till -52). Do the same for the first column of the matrix.





=> Filling up the matrix
Just consider the labeled cell of the matrix in the figure below. We will fill up this cell upon the basis of fixed protocol. We have to calculate 3 values: (Value of the Diagonal Cell+ Match/Mismatch Value), (Value of the Top Cell+Gap Value), (Value of the Left Cell+ Gap Value). Now we have to select the greatest value, to fill up the cell. In the given example, the 3 values would be, (0+5=5), (-4-4= -8), (-4-4= -8); since 5 is the greatest value, we shall fill up the cell with 5.

Then make another similar matrix. In that fill up the same position, with the type of value you have chosen i.e. - whether the diagonal value is selected, the top value is selected or the left value is selected.

Continue filling both the matrix
Figure2- Filled up matrix




Figure3- Filled up Location matrix





=>Tracing back

Figure4- Tracing back of the matrix

Based upon the second matrix, we shall trace back. Our start position is the last cell of the last row, and our stopping position should be the first cell of the first row.

If the cell has diagonal value(D), our arrow should move towards the diagonal cell. If the cell has top value(T), our arrow should move towards the top cell. If the cell has left value(L), our arrow should move towards the left cell. If the cell has 2 values(DT or DL or TL), then 2 arrows will be made and they shall move according to the corresponding values. If the cell has 3 values, then 3 arrows will be made and they shall move in all the 3 directions(diagonal, top, left).

After we have obtained the trace back matrix, we shall do the final alignment.




Final Alignment on the basis of first pathway in matrix is:-

Figure5- First pathway in the matrix

If a cell has diagonal arrow, arising from it, then there will be a match. Example- Just consider the brown labeled cell in the above diagram, since it has a diagonal arrow arising from it, P from the left axis and P from the top axis would be a match.

If the cell has vertical arrow arising from it, then there will be a gap along the query sequence. Example- Just consider the green labeled matrix in the above diagram, since it has a vertical arrow arising from it, there would be a gap along the top axis.

If the cell has a horizontal arrow arising from it, then there will be a gap along the subject sequence. Example- Just consider the pink labeled matrix in the above diagram, since it has a horizontal arrow arising from it, there would be a gap along the left axis.

Figure6- Final Result on the basis of the first pathway






Similarly do Final Alignment on the basis of second pathway in matrix:-

Figure7- Second Result on the basis of the first pathway






Figure8- Final Result on the basis of the second pathway


Both these alignments are correct. I hope you have understood this concept, if not feel free to comment and I shall solve your doubts.










Monday, April 21, 2008

How to completely hide your folders!!!!

My friend gave me a tip which is very useful. By using this tip, you will be able to completely hide your folder. Your folder will not be seen, even if the option of "Show Hidden Folders" is enabled. Also, your folder will not be detected by search option of Windows XP.

The trick is simple:-

Step1
Suppose you have a folder named "Max" and the folder is located in C: , the location of that folder would be C:\Max.

Step2
Go to Command prompt. Simply type "cmd" in run(of course without the quotes).

Step3
Type "attrib +s +h C:\Max" (of course without the quotes) and the folder becomes invisible. To make the folder visible again, simply type "attrib -s -h C:\Max".

My humble suggestion is to try this trick on an empty folder initially, in case something goes wrong. Caution- Do not forget the location of the folder, you have made invisible, I suggest that you save the location of the folders, you intend to make invisible. This trick is applicable, not only to folders, but files(all types of files) also.

Sunday, February 17, 2008

C++

C++ is a mid-level computer language. It is a multi paradigm, free form, compiled, statically typed computer language. It supports data abstraction, generic programming, object oriented programming, and procedural programming.

Did you understand the meaning of the underlined worlds? Honestly speaking, I did not! I further read and and came out with the following interpretation of the underlined worlds.

  • Multi paradigm- C++ language supports both object oriented paradigm and procedural paradigm, hence it is multi paradigm.
  • Free form- Initially the computer languages that were formulated , had the code to be written in specific columns. In C++, the code can be written in white space, hence it is free form.
  • Compiled- C++ uses a compiler. A compiler, scans the entire code, line by line, and reports errors and warnings if any. A compiler is different from an interpreter. When an Interpreter is used , the errors(most of them) are reported immediately while the code is being written.
  • Statically typed- The C++ compiler accepts letters, numbers, characters in a particular type. In statical typing, the typing is done during design time. In dynamic tying the typing is done during run time.
  • Data abstraction- In C++ the object ca have many features.Only particular features of the object is written in the code. The particular features are written in the class of the object, and the class is known as data abstraction type.
  • Generic Programming- C++ has generic programming features.
  • Object Oriented Programming(OOP)- C++ uses objects, to develop applications. These objects interact with one another via various techniques namely Inheritance, Encapsulation, Polymorphism, Modularity.
  • Procedural Programming- A procedure can be function, method, routine, sub-routine. In procedural programming, a procedure can be called from any other procedure, without writing the whole code again.
C++ Language is an advancement of C Language and it was designed by Bjarne Stroustrup.

Tuesday, January 22, 2008

Anti matter

Anti-matter is a particular type of matter which is composed of particles which are antiparticles to particles of matter.

Example:- Positron is an electron which has positive charges, an anti proton is a particle which has negative charge.

Significance of anti-matter is that when matter and anti-matter particles collide a lot of energy is released, in accordance to Einstein's equation, E=mc2

where E is Energy, m is rest mass, c is the speed of light.

In matter antimatter reaction, the entire rest mass is converted into energy, hence the reactions are highly efficient. These reactions are more efficient than nuclear fusion reactions, and much more efficient than reactions used in space fuel. The energy is released at the speed of light from the point of annihilation.

If we could master the technology of conducting matter antimatter reactions, all our energy problems would be solved. About 11-12 picograms of antimatter is produced annually most of which is produced in C.E.R.N( European Organization for Nuclear Research). Antimatter particles are the most expensive components priced at an astounding $300 billion per gram.

Sunday, December 30, 2007

Working of a Photocopier



  • The drum is shown, it comprises of a coating of selenium. Selenium is a photo conductive material; the property of a photo conductive material is that when light falls upon it, it gets charged. The drum gets charged by high voltage wire. The document to be photocopied is illuminated by light, the white part of the document reflects maximum amount of light, when this light falls on the drum, the negative charged gets diminished by earthing; the written material on the document reflects least amount of light, and corresponding areas of the drum have negative charge. Thus a virtual electrical image is formed on the drum.
  • The toner are small particles of ink which are positively charged, they get attached to the negatively charged particles on the selenium.
  • The paper which is inserted is attributed a negative charge, which is higher in magnitude as compared to the negative charge on the drum. The toner particles get attached to the paper. The toner is melted and fused in the paper, by a combine action of heat and rolling effect.
  • The drum continuously roates during the process of photocopy. Before the next cycle of photocopying begins, the drum is discharged.

Tuesday, December 25, 2007

The Big Toe- world's largest bike


The Big Toe is the world's largest bike. This monster is 2.3m(7.5 feet) high and 5m wide, weighing an astonishing 1645kg.

I
t has custom designed hydraulic suspension and small supporting wheels to keep it upright. The control panel has the start button and a 5000W speaker with CD player is built within the bike.

It has a top speed of 100km/hr(62mph). It is more of a show bike rather than a street bike. It is not designed to travel at high speeds. It is powered by
1975 Vintage Type E Jaguar SOHC 2 valve 60 degree 300HP 5.3L 12cylinder engine. Intake comes from 45mm twin choke Weber carburetors and a custom stainless muffler system handles the exhaust.

The man responsible for this bike is Tom Wiberg of Sweden. This bike is listed in the
Guinness Book of World records as the tallest driveable motorcycle in the world.






Sunday, December 16, 2007

did you know?

In this thread I will post some interesting science facts :-

  • did you know, a fly when alighted on top of a steel bar causes the bar to bend under its weight. the magnitude of bend is extremely small(1/1000 of a centimeter).
  • did you know, if a set of fine scales is arranged, so that one scale is kept dark and light is allowed to fall on another scale, the lighted scale will sink slowly. Light has "weight"; the pressure of light on earth's surface is calculated as 2 pounds per square mile.
  • did you know, there are very few animals on this planet which are not eaten by something else. One of them is the firefly. The adult firefly with its glowing body has no know predator.
  • did you know, every word we speak requires the use of 72 muscles in our body.
  • did you know, that a flea accelerates from a standstill to 3 feet per second in less than two thousand of a second subjecting it to a force of 150G. This is roughly equivalent to the force that a driver will experience driving a truck in a brick wall at the speed of 200 miles/hour.

Sunday, October 7, 2007

useful tips

How to resize recyclebin
By default, certain amount of your hard disk space is utilized by the recycle bin. In general, it is10%( example- if your hard disk space is 200gb, then the space reserved for recycle bin is 20gb). Now, thats a considerable amount, fortunately the settings of the recycle bin can be changed by clicking on "properties", and the recycle bin can be deemed to hold less space.

Take iPod instead of your laptop when traveling
An iPod (and other portable USB storage devices) can hold computer files, Outlook data, Internet Explorer favorites, desktop wallpaper, and in some cases applications. Connect the iPod to a borrowed PC and it is like having access to your own computer. Later, sync the iPod with your PC back home.

Promote your blog for free
Promote your website of blog for free by making a lens on the Squidoo website. Check out http://www.squidoo.com/ for more information. A Squidoo web presence gives you high rankings on the search engines, particularly Goggle.





Thursday, September 20, 2007

groovy gadgets
















Memory Glasses

Eyeglasses that include a small video camera attached to a wearable computer that has been programmed to recognize certain faces and objects and then tell the user what they are seeing. It will also help us to remember those crucial bits of information that are needed during exams.
Don't you think that for this reason alone, the glasses are worth looking through?















THUMP 2
The world's first digital music eye wear is now available in a new design. Built around the hard-edged style of futuristic eye wear. It offers a memory storage up to 1GB. That around 240 songs in a fully integrated design that frees you from danging cords and wires. Listen to music virtually anywhere with speaker booms that adjust easily for a customized fit, and just swing them out of the way when you need to hear your environment. For all-day comfort, the durable frame is made of lightweight material. Patented Optics extends clarity to the lens periphery, allowing for contours that open peripheral vision.



SELF CLEANING CLOTHES
Familiar with the site of seemingly endless laundry cycles and clothes continuously piling up in the hamper? Self cleaning clothes are made by placing pieces of cotton fabric in a liquid-based titanium dioxide for 30 seconds, then transferring them to an oven here they are heated to 97°C
for 15 minutes. Lastly they are placed in boiling water for 3 hours. It was observed that as long as it was exposed to sunlight, titanium oxide would continue to break down dirt particles into smaller particles into smaller particles, like carbon dioxide and water.